View Single Post
Old 11-21-2013, 07:16 AM   #2
Sergio.pv
Member
 
Location: Berlin

Join Date: Jul 2013
Posts: 20
Default

I did the following, as a test:
first, i use the above metioned sequences (identical as you can see)
>bta-let-7b MIMAT0004331
UGAGGUAGUAGGUUGUGUGGUU
>dummy
UGAGGUAGUAGGUUGUGUGGUU

gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80% >map.out 2>map.log

Output:
HD VN:1.0 SO:unsorted
@SQ SN:bta-let-7b LN:22
@PG ID:gmapper VN:2.2.3 CL:gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80%
dummy 0 bta-let-7b 1 250 22M * 0 0 NGAGGNAGNAGGNNGNGNGGNN *

Which is ok.

But if I change the dummy sequence (U -> T), into the original output of the sequencer (Us as Ts) i don't get results:
@HD VN:1.0 SO:unsorted
@SQ SN:bta-let-7b LN:22
@PG ID:gmapper VN:2.2.3 CL:gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80%

It seems that the use of Ts is not computed. Is that correct?, is there an option to modifify that?

Best!
Sergio.pv is offline   Reply With Quote