SEQanswers - View Single Post - puzzle with gmapper -M mirna (shrimp)

Sergio.pv · 11-21-2013, 07:16 AM

I did the following, as a test:
first, i use the above metioned sequences (identical as you can see)
>bta-let-7b MIMAT0004331
UGAGGUAGUAGGUUGUGUGGUU
>dummy
UGAGGUAGUAGGUUGUGUGGUU

gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80% >map.out 2>map.log

Output:
HD VN:1.0 SO:unsorted
@SQ SN:bta-let-7b LN:22
@PG ID:gmapper VN:2.2.3 CL:gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80%
dummy 0 bta-let-7b 1 250 22M * 0 0 NGAGGNAGNAGGNNGNGNGGNN *

Which is ok.

But if I change the dummy sequence (U -> T), into the original output of the sequencer (Us as Ts) i don't get results:
@HD VN:1.0 SO:unsorted
@SQ SN:bta-let-7b LN:22
@PG ID:gmapper VN:2.2.3 CL:gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80%

It seems that the use of Ts is not computed. Is that correct?, is there an option to modifify that?

Best!

11-21-2013, 07:16 AM	#2
Sergio.pv Member Location: Berlin Join Date: Jul 2013 Posts: 20	I did the following, as a test: first, i use the above metioned sequences (identical as you can see) >bta-let-7b MIMAT0004331 UGAGGUAGUAGGUUGUGUGGUU >dummy UGAGGUAGUAGGUUGUGUGGUU gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80% >map.out 2>map.log Output: HD VN:1.0 SO:unsorted @SQ SN:bta-let-7b LN:22 @PG ID:gmapper VN:2.2.3 CL:gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80% dummy 0 bta-let-7b 1 250 22M * 0 0 NGAGGNAGNAGGNNGNGNGGNN * Which is ok. But if I change the dummy sequence (U -> T), into the original output of the sequencer (Us as Ts) i don't get results: @HD VN:1.0 SO:unsorted @SQ SN:bta-let-7b LN:22 @PG ID:gmapper VN:2.2.3 CL:gmapper-ls dummy-seq.fa dummy-let-7b.fa -N 12 -o 10 -h 80% It seems that the use of Ts is not computed. Is that correct?, is there an option to modifify that? Best!