Hi all,
I am trying to convert the following type of code into bed format or really anything that I can view in IGV or IGB browsers. I think it is in eland sorted format, but not too sure.
I looked around and found that I might be able to use SAMTOOLS or FINDPEAKS. This is probably a simple conversion, but I'm not too familiar with the implementation of these programs so I'd really appreciate any help.
Thanks in advance!
I am trying to convert the following type of code into bed format or really anything that I can view in IGV or IGB browsers. I think it is in eland sorted format, but not too sure.
Code:
HWI-EAS240 FC2087UAAXX 3 257 951 322 TGTTGTCTCTCTTCTGGGTCTAGCCACCTAGCAAGT [[[[[[[[[[[[[[[ZZU[[[[U[[Z[[X[VSSOVS chr10.fasta 53590 R 33G2 0
I looked around and found that I might be able to use SAMTOOLS or FINDPEAKS. This is probably a simple conversion, but I'm not too familiar with the implementation of these programs so I'd really appreciate any help.
Thanks in advance!