Tweet
yes, I think..see the link from where I got those files
-
-
That's normal, the fasta file(s) (*.fa) is/are used to make the indices (*.bt2), so there's no reason for it to create a copy.Comment
-
I think the fasta file is in fasta format, as when I open it in texteditor, the first few lines looks like this
>1
CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAATCTTTAAATCC
TACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTTCTCTGGTTGAAAATCATTGT
GTATATAATGATAATTTTATCGTTTTTATGTAATTGCTTATTGTTGTGTGTAGATTTTTTAAAAATATCA
TTTGAGGTCAATACAAATCCTATTTCTTGTGGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTATCTTC
ATTTGTTATATTGGATACAAGCTTTGCTACGATCTACATTTGGGAATGTGAGTCTCTTATTGTAACCTTA
GGGTTGGTTTATCTC,
when i open this file in the terminal it looks
cat Arabidopsis_thaliana_NCBI_TAIR10/Arabidopsis_thaliana/NCBI/TAIR10/Sequence/Bowtie2Index/genome.fa
XSym
0029
7ec8fcfa270da919afc1f0afd221e788
../WholeGenomeFasta/genome.fa
so fasta file seems to be goodComment
-
ok,,now I understand that why I don't see copy of fasta file, when I create indicesComment
-
Ah, after a bit of googling and a hunch, are you using Mac OSX and these files are being held on a fat32 formatted file system (likely an external hard drive, or maybe even a network share via samba)? That is what a symbolic link looks like in these situations (who knew?). If you get this result when you use cat, then I expect the link is also not transparent for gtf_to_fasta. In that case, you might have to copy the ../WholeGenomeFasta/genome.fa file to Arabidopsis_thaliana_NCBI_TAIR10/Arabidopsis_thaliana/NCBI/TAIR10/Sequence/Bowtie2Index/genome.faOriginally posted by hathiram2 View PostComment
-
libz warning?
dpryan, how does one ignore the libz warning? I got that warning while trying to use bam2fastx from top hat 2.0.9...Originally posted by dpryan View PostComment
-
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...04-22-2024, 07:01 AM -
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...04-04-2024, 04:25 PM
Comment