View Single Post
Old 03-01-2016, 06:53 PM   #1
jfeicheng
Junior Member
 
Location: shanghai

Join Date: Feb 2014
Posts: 2
Default does read order influence bwa mapping?

I'm doing alignment with bwa (0.7.5a-r405).
But I found that the same sequence in different position may influence the mapping result.

As you may noticed, the read1 and read3 are exactly the same, but the mapping result is different.

read1 0 Chr3 209 0 50M * 0 0 CAAAGGTGCGGCCCGAGGTAAAGGGTTTAACGCTTCATATTTTATCACAT HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH XT:A:R NM:i:0 X0:i:2 X1:i:1 XM:i:0 XO:i:0 XG:i:0 MD:Z:50 XA:Z:Chr11,-26081473,50M,1;
read2 0 Chr3 208 0 50M * 0 0 ACAAAGGTGCGGCCCGAGGTAAAGGGTTTAACGCTTCATATTTTATCACA HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH XT:A:R NM:i:0 X0:i:2 X1:i:1 XM:i:0 XO:i:0 XG:i:0 MD:Z:50 XA:Z:Chr3,+4840,50M,0;Chr11,-26081474,50M,1;
read3 4 * 0 0 * * 0 0 CAAAGGTGCGGCCCGAGGTAAAGGGTTTAACGCTTCATATTTTATCACAT HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH

Does anyone know what's happening here?

the command line:
input=$1
bwa aln genome.fa $input >${input/.fq/}.sai
bwa samse -f ${input/.fq/}.sam genome.fa ${input/.fq/}.sai $input

Last edited by jfeicheng; 03-01-2016 at 07:07 PM.
jfeicheng is offline   Reply With Quote