View Single Post
Old 07-29-2014, 12:45 PM   #1
AnneBiton
Junior Member
 
Location: California

Join Date: Aug 2012
Posts: 5
Default STAR: Alignment reported with less matches than parameter --outFilterMatchNmin

Hello,

I am using STAR_2.3.0e.Linux_x86_64 to align only the first 25b of my paired-end reads, with the parameters:
--outFilterMatchNmin 40

--clip5pNbases 4 (there 4 random pairs before the PCR primer that I want to remove)

--clip3pNbases 71 (in order to only keep the first 25 bases)

--outSAMattributes All

--outFilterMultimapNmax 3

--outFilterMismatchNmax 5

--outFilterMismatchNoverLmax 0.05

--alignIntronMax 1

--alignMatesGapMax 740

I have cases like below where one mate of a pair is multiply mapped but with alignments containing a sum of matches that is less than 40, although I asked for a minimum of 40 matches using the parameter --outFilterMatchNmin.

I don't understand why these alignments are recorded while they have less than 40 perfect matches (required using --outFilterMatchNmin).

Any advice or guidance will be welcomed, thank you!

Best,
Anne

HISEQ:97:H8U2HADXX:1:1101:3459:2064 355 CXCL3 328 3 4S25M71S = 428 111 AATTATGACAGGGTGGGGAACTGGAGGGTGGGGGGATTGAAATGCAAGCAATTAGTGGATCACTGTTAGGGTAAGGGAATGTATGTACACATCTATTTTT @C@DDFFFHHGGFACHEGIGGIGIHIII?DHIJJD8BDCDDCDDDDCCDDDDDCCDDDCDABDDDDDDDDD9ACCDDBDDDCCCD>B>CCCCDCDEEEED NH:i:2 HI:i:2 AS:i:34 nM:i:0 jM:B:c,-1 jI:B:i,-1

HISEQ:97:H8U2HADXX:1:1101:3459:2064 403 CXCL3 428 3 81S11M8S = 328 -111 TTTGCTTTATAGGTTATTTTATTTTTATTTCTCTAATTCCTGGGTTTTTTTTTTTCTCTTAAAAAAAATATTTTTTATTTTCTTTTTTTTTATTGCCTTT #################################################################################################### NH:i:2 HI:i:2 AS:i:34 nM:i:0 jM:B:c,-1 jI:B:i,-1
AnneBiton is offline   Reply With Quote