View Single Post
Old 09-06-2017, 06:42 AM   #1
anotherSAM
Junior Member
 
Location: Paris

Join Date: Sep 2017
Posts: 5
Default PacBio raw .bam file

I have just received data from my first PacBio sequencing operation and was unaware that the new output format was in .bam file for raw reads, as they are calling the 'better fastq'.
I am using a pipeline, beginning with canu, which requires a fastq file however when using both samtools and bamtools to generate a fastq file from the bam file, the quality row just contains exclamation marks

samtools bam2fq data.bam > data.fastq
bamtools convert -format fastq -in data.bam -out data.fastq

e.g.
@read1
ATGCATGCAGCTGATGCTAGCATGCTACTAGTCGATCGTAGCTAGTCGATCGATGCTAGCATCGATGCTAGCTAGTCGATGCTAGCTGCGTAGCTGATGATGCTAGTCGACTGATACGAT
+
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!


Additional output files were a bam.pbi, an xml and a fasta file

Does anyone know how to handle the raw read bam files in order to generate fastq files with the appropriate quality score?

Last edited by anotherSAM; 09-06-2017 at 07:42 AM. Reason: grammar
anotherSAM is offline   Reply With Quote