Hi,
I am new to deep sequencing and would like a little help. I am trying to design custom primers to use on one end of my fragmented DNA for a Nextera Miseq. I am wondering if my primers need any modifications such as phosphorylations to be able to bind to the chip, or if I can get away with discluding the i5/i7 sequences.
I have designed two primers (to match the P7 or P5 end that would be randomly inserted due the random inserts of tagmentation). My primer design looks like this:
Primer to be paired with P5:
5' CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTACCCTCCTGCTTAAGGGC
Primer to be paired with P7:
5' AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTACCCTCCTGCTTAAGGGC
*Red = P7/P5 ends complementing chip oligo
*Green = transposon adaptor sequence
*3' black end = transposon sequence
*Brown = complementing region to DNA
Please let me know if you see any problems in this design and let me know if you think it will work. Thanks.
I am new to deep sequencing and would like a little help. I am trying to design custom primers to use on one end of my fragmented DNA for a Nextera Miseq. I am wondering if my primers need any modifications such as phosphorylations to be able to bind to the chip, or if I can get away with discluding the i5/i7 sequences.
I have designed two primers (to match the P7 or P5 end that would be randomly inserted due the random inserts of tagmentation). My primer design looks like this:
Primer to be paired with P5:
5' CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTACCCTCCTGCTTAAGGGC
Primer to be paired with P7:
5' AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTACCCTCCTGCTTAAGGGC
*Red = P7/P5 ends complementing chip oligo
*Green = transposon adaptor sequence
*3' black end = transposon sequence
*Brown = complementing region to DNA
Please let me know if you see any problems in this design and let me know if you think it will work. Thanks.
Comment