View Single Post
Old 02-07-2017, 01:39 PM   #420
YeastGuy
Junior Member
 
Location: here

Join Date: Feb 2017
Posts: 4
Default

Quote:
Originally Posted by Brian Bushnell View Post
How are the ORFs indicated? Do you have them in a separate file (gff/gtf/bed)? BBMap doesn't use any of those, though you could probably use a different tool to mask the reference with them. Generally, I don't recommend constraining alignment to a specific subset of the genome, which incurs confirmation bias.
I tried to simply use the multi-fasta format with the hope that the sequences would be seen as seperate and not connected:
>lcl||1|YAL001C|TFC3|1|145
TAGTTACTATGGTCGTTAACGAAATAATATTTCATCCAGGGA
>lcl||2|YAL002W|VPS8|1|145
CTGGTCTGGACCCATTACTTTTTCTAGCTTGGGAAAATGTACAG

But after randomising the order withing the ref file the coverage changed.
YeastGuy is offline   Reply With Quote