how to exclude the known ncRNA

[EADIE]

I have some data of Arabidopsis for small RNA analysis. Now i want to do a locall alignment with Rfam then exclude the sequences which match to Rfam from futher analysis. But the question is:
Do i need to extract the relevant Arabidopsis members of the Rfam before alignning? If it's best to do that, how should i deal with members with no species name? Do they also need to extract for matching? These members are as follows:

>RF00005;tRNA;AAVX01183092.1/735-806 :
GTCCCATAGCATTGTGGTTTGCGTATTCGCCTTGCAAGCGAGAGGATCTG
GGTTCGATTCCCAGGTGGGGCA
>RF00005;tRNA;AAVX01300616.1/338-420 :
GTAGTTGTGGCTGAGTGGTTAAGACAATGGACTAGAAATCCACTAGAAAA
CTACCCGCGCAGGTTCGAATCCTGCAGACTACG
>RF00005;tRNA;AAVX01004056.1/1665-1747 :
GAAGTATTGGCCGAGTGGCGAAGGCGATGGACTACAAATCCATTGAGAAA
CTTCCCGCGCTGTTTCGAATCCTGCCGACTACG

Looking forward to your reply~~
Thank you in advance!

[KevinLam]

Sounds like a generic qn. Perhaps u may wish to move ur thread to the bioinfomatics subforum?

[EADIE]

Sounds like a generic qn. Perhaps u may wish to move ur thread to the bioinfomatics subforum?

KevinLam, thanks for your advice!

[bioinfosm]

I used ncrna.org, but that was for human data. Probably they have arabidopsis as well

[EADIE]

I used ncrna.org, but that was for human data. Probably they have arabidopsis as well

Thanks for your information!