View Single Post
Old 01-15-2014, 08:37 AM   #1
clintp
Member
 
Location: Georgia

Join Date: Apr 2013
Posts: 19
Default Miseq:Trimming, and sequencing primers at the beginning of a read

I noticed that when I trim my Miseq reads for adapter contamination (getting rid of the 3' portion of the read), I could still grep the trimmed reads for ACACTCTTTCCCTACACGAC (the sequencing primer/adapter sequence) and find several thousand at the 5' end of Read1 reads. These shouldn't be there, right? What am I missing?

I used fastq-mcf to trim the 13bp common TruSeq sequence AGATCGGAAGAGC.

Primer sequences do not appear in the beginning of Read2 reads. In the sample sheet, I did not request that the MiSeq do any onboard trimming. For library prep, I used NEBNext Ultra, whose adapters, seq primers, and indicies are the same as the TruSeq stuff.

So, my questions are 1) why am I getting primer sequences in read 1? and 2) Is the 13bp sequence sufficient for trimming Illumina reads (and should I be doing this differently--the reads are used for de novo assembly and blast-based binning, so aggressively getting rid of adapter sequences is important to me)?
clintp is offline   Reply With Quote