Hi all,
I am doing some analysis on the dataset here:
Some basic info for the data without looking into above link:
----
Illumina Genome Analyzer IIx paired end sequencing
shotgun sequencing
WGS
Pseudomonas fluorescens
Paired-end
----
When I search for 'Genome Analyzer IIx', could find the quality encoding information. I have seen that the quality scores for all bases are '?', e.g.
@ERR1363506.14 226/1
GTCCACTACAGGTCGAAGCCGAAGGCGACGAGTTGCGTGTTTACGCGCCCAATCGTTTTGTTCTCGACTGGGTCAACGAGAAGTACCTGAGCCGCGTGCT
+
????????????????????????????????????????????????????????????????????????????????????????????????????
My question is:
Is it normal to have a identical quality score for all bases?
When I analysis the data, some bio tools report errors that it cannot detect the quality offset or quality encoding, is above the cause of the errors?
Thanks.
I am doing some analysis on the dataset here:
Some basic info for the data without looking into above link:
----
Illumina Genome Analyzer IIx paired end sequencing
shotgun sequencing
WGS
Pseudomonas fluorescens
Paired-end
----
When I search for 'Genome Analyzer IIx', could find the quality encoding information. I have seen that the quality scores for all bases are '?', e.g.
@ERR1363506.14 226/1
GTCCACTACAGGTCGAAGCCGAAGGCGACGAGTTGCGTGTTTACGCGCCCAATCGTTTTGTTCTCGACTGGGTCAACGAGAAGTACCTGAGCCGCGTGCT
+
????????????????????????????????????????????????????????????????????????????????????????????????????
My question is:
Is it normal to have a identical quality score for all bases?
When I analysis the data, some bio tools report errors that it cannot detect the quality offset or quality encoding, is above the cause of the errors?
Thanks.
Comment