View Single Post
Old 11-07-2008, 02:57 PM   #1
sgupta
Junior Member
 
Location: Cambridge, MA

Join Date: Nov 2008
Posts: 6
Default ABI Color Space to Bases

Hi,

I am trying to convert color space sequences generated by ABI SOLiD sequencer to actually bases using the following color space data "matrix":

AA=0
AC=1
AG=2
AT=3
CC=0
CA=1
CT=2
CG=3
GG=0
GT=1
GA=2
GC=3
TT=0
TG=1
TC=2
TA=3

So, this
>44_35_267_F3
T20220213203000111000122223221121222

gets converted to

>44_35_267_F3
CCTCCTGCTTAAAACACCCCAGAGATCTGTCAGAG

I want to do this to be able to use alignment programs that cannot work with ABI color space data. But so far I think I am doing something wrong because my alignment rates are less than 5% using published data (allowing upto 2 mismatches, mouse genome).

Any insights would be really appreciated.

I may just go ahead and use MAQ to do this in color space but I am not sure why this does not work the way I am currently trying to doing it. I am very new to SOLiD data so I maybe missing some piece of information here.

Thanks in advance.
sgupta is offline   Reply With Quote