View Single Post
Old 12-22-2009, 02:47 AM   #4
byb121
Member
 
Location: Newcastle upon Tyne

Join Date: Aug 2009
Posts: 18
Default

Quote:
Originally Posted by maubp View Post
You have already got Sanger style FASTQ files from the NCBI SRA, and MAQ likes standard Sanger FASTQ files. You would only need to convert if you started with Solexa or Illumina encoded FASTQ files

Maybe the problem is something else - could you post the first 20 lines or so of the FASTQ file in the forum - use the [ code ] data [ /code ] tags to make it display nicely.
Thanks for replys.
Here's the 20 lines of the FASTQ file I downloaded from SRA
Code:
@SRR002051.1 :8:1:325:773 length=33
AAAGAACATTAAAGCTATATTATAAGCAAAGAT
+SRR002051.1 :8:1:325:773 length=33
IIIIIIIIIIIIIIIIIIIIIIIII'II@I$)-
@SRR002051.2 :8:1:409:432 length=33
AAGTTATGAAATTGTAATTCCAATATCGTAAGC
+SRR002051.2 :8:1:409:432 length=33
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII07
@SRR002051.3 :8:1:488:490 length=33
AATTTCTTACCATATTAGACAAGGCACTATCTT
+SRR002051.3 :8:1:488:490 length=33
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII&I
@SRR002051.4 :8:1:899:554 length=33
AGATTTCTAATATGGTTAAGAAGCGAACTTTTT
+SRR002051.4 :8:1:899:554 length=33
IIIIIIIIIIIIIIIIIII?IIIIII<IIIIII
@SRR002051.5 :8:1:464:463 length=33
AAAGCAGCAGCACGTAGTTCTTCATCCTTCTTC
+SRR002051.5 :8:1:464:463 length=33
IIIIIIIIIIIIIIIIIIIIIIIFIIIIII%.I
This is the first 20 lines of the FASTQ file that I converted from the BFQ file.
Code:
@SRR002051.1
AAAGAACATTAAAGCTATATTATAAGCAAAGAT
+
:8:1:325:773``````=33IIIIIIIIIIII
@I$)-
NNNNNNNGTNAAGTTATGAAATTGTAATTCCAATATCGTAAGC
+
!!!!!!!5:!73``````=33IIIIIIIIIIII""""""""""
@SRR002051.3
AATTTCTTACCATATTAGACAAGGCACTATCTT
+
:8:1:488:490``````=33IIIIIIIIIIII
@SRR002051.4
AGATTTCTAATATGGTTAAGAAGCGAACTTTTT
+
:8:1:899:554``````=33IIIIIIIIIIII
@SRR002051.5
AAAGCAGCAGCACGTAGTTCTTCATCCTTCTTC
+
:8:1:464:463``````=33IIIIIIIIIIII
Clearly, short read SRR002051.2 has both wrong sequence and incorrect quality scores. I checked several more reads which have '@' in quality scores, they have the same problem.

Last edited by byb121; 12-22-2009 at 03:38 AM.
byb121 is offline   Reply With Quote