View Single Post
Old 05-14-2012, 04:08 AM   #7
rahularjun86
Member
 
Location: Frankfurt(M), Germany

Join Date: Jan 2011
Posts: 58
Default

Hi,
One could also try simple grep to have a rough idea regarding the adapter sequences.
HTML Code:
grep -c "^GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG" *.fastq
grep -c "GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG$" *.fastq
grep -c "GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG" *.fastq
You can also try 13-mer sequence.
Thanks,
Rahul
__________________
Rahul Sharma,
Ph.D
Frankfurt am Main, Germany
rahularjun86 is offline   Reply With Quote