View Single Post
Old 09-19-2015, 09:52 AM   #3
mcarson
Junior Member
 
Location: Canada

Join Date: Sep 2015
Posts: 5
Default

@MISEQ06:359:000000000-AEFPR:1:1101:16407:1545 1:N:0:ACATCTTGACG
TTCTAGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTACAGCGCACGTAGGCGGTTTTTTAAGTCATTTTTGACATCCCCCGGCTCCACCTTGGCACTTCCTTTGCTACTTTCCTTCTTGAGTCTCTCAGAGTTCCTTTGCTTTCCCGTTTTAGCGGTGACCTTCTTCGATATCTGTATGCACCCCCTTGTCGCCTGCTGCTTTCTGTTTTCTCCCTGACTCTTCGGTCCGCACGCCTGGTGAGCCACCATGATTAGATACCCTTTTAGTCCTTCT
+
@BCCCGGGGFG@FGFFF@F:FGDGGGGGGDGGGGGGGEGGCGGGGGC,B,6CF,CC9C,CCGG+B,C6>+@>C####################################################################################################################################################################################################################################
@MISEQ06:359:000000000-AEFPR:1:1101:16407:1545 2:N:0:ACATCTTGACG
CCGCCCTCCTCGTTTTTCTTCTCCTTTTTCCTCCCCCCTCTTTCGCTCCTCCCCCTCTCTTTTTACCCCCTCCCCTCCCTTCCCCCTCTTTTTTCTTCCCTCTCTCTACCCTTTTCCCCTCTCCCTCCTCCCTTCCCCTCTCCTCTCTTCCACTCCCCTCCCTCTGTTCCCCTTTCCTTTCCCCTTTTTCCCCCTCCTCTTTCCCCCCTCCCTTCCCCCCCCCCCTCCCCCCCCTTTTCCCCCCTTCTTTCCTTTTCCCCCCCCCCCCCCCCTTTTTTCCCCCCCCTCTCCCCCTTCTCCC
+
-8,-,86,8;C---9696;,,6;;;6CC<,;6<EEE#########################################################################################################################################################################################################################################################################
@MISEQ06:359:000000000-AEFPR:1:1101:20149:1557 1:N:0:ACATCTTGACG
TGCAAGTGCCAGCCGCCGCGGTCATACGGAGGGTGCGAGCGTTGTTCTGCATTCTTGGGCGTACCGCGCGTGTAGGCGGTTTTTTCCGTCTTTTTTGCCCTCCCTCTTCTCCCCCCTGTCCCTGCCTTCGCTCCTTTCTTTCTTTCTTTCTTTCTCTTTTTTTTTCCTTCCTTTTTTCTCTTTTCACTCCTTCTCTCTCCTTCTTCACCCCTTTTTCTCCTTCTTCTTTCTTTCTCTCTCCTTACTCTCCTTCTCTCCCTCTTATTGCTCCCCCTTTATTATCTACCCTTTTAGTCCTTTT
+
@8ACCGGGFFG8FF:CF@F:FF+CFGGGGGGGGGGGGFGGDFGGGGF,C,<<C,CC,,:CFFC+,,8+>>>+B,,,:++86?AA@,,+:B?##################################################################################################################################################################################################################
@MISEQ06:359:000000000-AEFPR:1:1101:20149:1557 2:N:0:ACATCTTGACG
CCGCCCTACCTTTTTTTCTCCTCCTTTTTCCTCCCCTATCCTTCTTCCATCCCCCTCTCTCTTCCCCCCCTCCCCCCCCTTCCCCCCCTTTTTTCCTCCTTTTCTCTCCCTCTTTCCCCCCTCCCCCCCCCTTTCCCCTCCCCTCTCCCTTCTCCCCCTCTCCCCTTTTCCTCTCCCCTTCCCCTTTTCCCCCCCTCCCTTTCCCCTCCTCCTTTCCCCCCCCCCTCCCCCCCCTTTCCCCCCTTTCCTTCCTCCCCTCCCCCCCCCCCCCCTTTTTCCCCCTCTCGCTTCCCCTTCCCTC


This is the raw data from JGI. 1:N:0 is the forward 2:N:0 is the reverse and I've used extract_reads_from_interleaved_file.py to split them with no problems. From what I can tell the barcode is in the label not the sequence and you can extract them if need be using extract_barcodes.py -c barcode_in_label. Beyond that I'm a little lost. I've checked the fastq's and am fairly certain the forward read has a 5bp linker and the reverse has a 2bp one, followed by the V4 region primers (F5'GTGCCAGCMGCCGCGGTAA:R5'GGACTACHVGGGTWTCTAAT). I've also heard there were phiX internal controls added.

I hope to end up with linkers/adapters removed, as well as any other filtering/label renaming that needs to be done prior to aligning forward a reverse reads in PANDAseq.
mcarson is offline   Reply With Quote