View Single Post
Old 12-12-2013, 09:17 PM   #12
arcolombo698
Senior Member
 
Location: Los Angeles

Join Date: Nov 2013
Posts: 142
Default

Quote:
Originally Posted by arcolombo698 View Post
Hello. thank you for the response!

So I updated the Trimmomatic, and am not sure which adapter to use , which they provide for the users?

essentially, none of the adapters they provide, match with the list that I have been given from Illumina.

yet the adapters found in Trimmomatic don't seem to match any of the ones on the attached list.

NexteraPE
>PrefixNX/1
AGATGTGTATAAGAGACAG
>PrefixNX/2
AGATGTGTATAAGAGACAG
>Trans1
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
>Trans1_rc
CTGTCTCTTATACACATCTGACGCTGCCGACGA
>Trans2
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
>Trans2_rc
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC




Essentially, the adapter from Truseq2- prefix/1 matches the universal adapter in the Illumina sheet.

However, I have multiple indices used from this sheet.

So how do I select the correct adapter from Trimmomatic?

Or how do I customize my own adapter sheet?


Here is my custom adapter.fa. I will upload my FastQC report after i finish running it.

Here is my original fastqc report for a sample that HAS ADAPTERS in it, this is before i did the trimmomatic

[WARN] Overrepresented sequences
Sequence Count Percentage Possible Source
GCAGATAGTGAGGAAAGTTGAGCCAATAATGACGTGAAGTCCGTGGAAGC 52178 0.18044319834652642 No Hit
AGTAGTATAGTGATGCCAGCAGCTAGGACTGGGAGAGATAGGAGAAGTAG 51279 0.17733425520356333 No Hit
GCTTTGGCTCTCCTTGCAAAGTTATTTCTAGTTAATTCATTATGCAGAAG 49511 0.17122011562986064 No Hit
TTTGATGGTAAGGGAGGGATCGTTGACCTCGTCTGTTATGTAAAGGATGC 44215 0.15290536269867885 No Hit
GCCATATCGGGGGCACCGATTATTAGGGGAACTAGTCAGTTGCCAAAGCC 32007 0.11068736727121142 No Hit
GTCAGTTCAGTGTTTTAATCTGACGCAGGCTTATGCGGAGGAGAATGTTT 31149 0.10772021130162042 No Hit
TTGTCAGTTCAGTGTTTTAATCTGACGCAGGCTTATGCGGAGGAGAATGT 31053 0.10738822182250535 No Hit
AGCTTTGGCTCTCCTTGCAAAGTTATTTCTAGTTAATTCATTATGCAGAA 30693 0.10614326127582382 No Hit
AGTTAGATTTACGCCGATGAATATGATAGTGAAATGGATTTTGGCGTAGG 29276 0.10124295823513564 No Hit
TGGTCTAGGGTGTAGCCTGAGAATAGGGGAAATCAGTGAATGAAGCCTCC 29193 0.10095592566465071 No Hit
arcolombo698 is offline   Reply With Quote