View Single Post
Old 04-03-2019, 01:30 AM   #1
Rosmano
Member
 
Location: Portugal

Join Date: May 2012
Posts: 20
Default Unable to do library amplification using the new Nextera DNA Flex Library Prep kit

Hello everyone,

I am trying to do a library of FACS sorted T-cells using the new Nextera DNA Flex Library Prep kit to perform ATAC-seq.
We are using adapters ordered from Sigma that have the same sequence as the Illumina ones:

Ad1 - AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
Ad 2.1 - CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
Ad 2.2 - CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT

I've already tested the following parameters:
- Tested different amounts of cells - 25k, 50k, 75k;
- Removed the final bead purification step and changed it by a MinElute column purification - when I performed this, my Bioanalyzer profile showed an enormous amount of adapter dimers and no library amplification at all;

Finally, Illumina had the following information in their page for the discontinued Nextera DNA Library Prep Kit:

Quote:
The Nextera DNA Library Prep Kit has been obsolesced. For whole-genome sequencing, Nextera DNA Flex Library Prep Kit is the recommended replacement product. For ATAC-seq and other custom applications, contact your local Illumina Sales representative to order stand-alone components TDE1 Tagment DNA Enzyme (Catalog No. 15027865) and TD Tagment DNA Buffer (Catalog No. 15027866). Illumina remains committed to providing you with high-quality support and service.
However, they've since made that page redirect to the new kit and now that information is no longer available. Has anyone been able to make the kit work?
Rosmano is offline   Reply With Quote