View Single Post
Old 01-16-2012, 01:12 AM   #5
ulz_peter
Senior Member
 
Location: Graz, Austria

Join Date: Feb 2010
Posts: 219
Default

So...
It seems the file you provided os no fasta file, as fasta files should look like
Code:
>header
ACGTACGACTCGACTACAGCAC
>header2
ACTAGCTGCATGCATC
and so on. You provided the Dictionary. You may download the fasta files for the chromosomes here:
http://hgdownload.cse.ucsc.edu/golde...9/chromosomes/

And then unzip them and merge them into one fasta file (GATK is picky about the order of the fasta file, it should be chr1, chr2 ,chr3, ...chrX, chrY), for example using the cat command in Linux; You may also try to download the hg19.2bit file and extract the sequence using the twoBitToFa binary.

Another source for a human reference genome would be the 1000genomes project:
ftp://ftp.1000genomes.ebi.ac.uk/vol1...cal/reference/

Hope that helps,
Peter
ulz_peter is offline   Reply With Quote