View Single Post
Old 03-28-2011, 08:41 AM   #1
JoaoMoura
Junior Member
 
Location: Barcelona

Join Date: Mar 2011
Posts: 2
Default RNASeq - overrepresent sequences

Hey guys!

First of all, I'm sorry If I'm puting this question in the wrong section, but I'm new to this forum.

Well, I'm doing DE with RNASeq and after doing some QA and QC (removed the solexa adapter and trimmed the reads) I still have an 2 overrepresented sequences from most of my fasta files, which are:

CGATGAAGAACGCAGCGAAATG

CCCCCTGGAATACCAAGGGGCG

Do you have any idea what they are?

Thanks a lot!
JoaoMoura is offline   Reply With Quote