View Single Post
Old 07-27-2011, 02:16 AM   #1
rogerholmes.novogene
Junior Member
 
Location: Beijing, China

Join Date: Jul 2011
Posts: 3
Default Help:scaffold 2 contigs!

Hi
I got a scaffold sequence file from SOAPdenovo like:
>scaffold1 13.6
AATCCGCCGAGATGGGCAGATCCCTTGAGCTCANNNNNNNAATCCGCCGAGATGGGCA
.
.


I need a perl script to remove "N"s and split the scaffold into contigs like:

>scaffold1 13.6 contig1
AATCCGCCGAGATGGGCAGATCCCTTGAGCTCA
>scaffold1 13.6 contig2
AATCCGCCGAGATGGGCA
.
.


I'm new in perl programming. Could anyone help me with that?

Thanks!
rogerholmes.novogene is offline   Reply With Quote