Hello,
I am currently testing a number of aligners with application to miRNA sequenceing and have come across a curious problem with bowtie. I run bowtie with the following options so should get all the perfect matches:
The index file is the human genome as supplied by the makers of bowtie.
For the sequence "TGGGAATACCGGGTGCTGTAGGCTTT" I get two hits one on chromosome 12 and the other on the X. When I blat this sequence I get 22 hits (chr1 * 16, 12*2, X*2, 17, 19).
Does anyone know why there is a difference?
I also applied the same dataset to novoalign,
, and get 23 perfect matches, with an extra chromosome 1 match.
I am very confused as to why there is so many differences and would welcome any help in this area.
Thanks
I am currently testing a number of aligners with application to miRNA sequenceing and have come across a curious problem with bowtie. I run bowtie with the following options so should get all the perfect matches:
Code:
./bowtie -p 4 --solexa-quals --best -k 100 -t h_sapiens_asm ../GDB1.fastq GDB1.map
For the sequence "TGGGAATACCGGGTGCTGTAGGCTTT" I get two hits one on chromosome 12 and the other on the X. When I blat this sequence I get 22 hits (chr1 * 16, 12*2, X*2, 17, 19).
Does anyone know why there is a difference?
I also applied the same dataset to novoalign,
Code:
./novoalign -rAll -f ../GDB1.fastq -d hsapiens > GDB1.map
I am very confused as to why there is so many differences and would welcome any help in this area.
Thanks
Comment