View Single Post
Old 03-28-2016, 07:38 PM   #1
Alphabets
Junior Member
 
Location: SZ

Join Date: Mar 2016
Posts: 7
Default Three reads with the same name in the BAM file

Hi all,

I am dealing with the paired-end BAM file, and come up with many warnings like this:

Code:
WARNING: Could not find pair for HWI-ST430:177:2:1:4979:15503#0
WARNING: Could not find pair for HWI-ST430:177:2:1:5127:13427#0
WARNING: Could not find pair for HWI-ST430:177:2:1:6521:21452#0
I check the warning reads in the BAM file, and find all the warning reads have three reads with the same name. For example:

Code:
HWI-ST430:177:2:1:4979:15503#0	65	chr32	26100696	60	79M21S	chr5	36697147	0	ACTTTGCAATTTAAGTTTTACTTACTTTTTAACTAATATACATGCCTAAAATTTACAAAAACAATAATAAAAACAACAGAACACTGGAAACATTTTTAAA	>;=<>=<<=======<====;===;=======<=>>>>>><=>>==>>>>=>>>>==>?>=<<==>?>>>?>?==><=?>><=<>>>?>?=>??>?===>	BD:Z:[email protected][email protected]@@[email protected]@	MD:Z:79	PG:Z:MarkDuplicates	RG:Z:Basenji	BI:Z:FFIECHGIHFEAFEEHEAAFFHDFFHDAAAFEEIHFGGHGGGHHGHHHFBBGFBGGGHBBBFGHGGFGGFBBBGHIGHJGHGHFKJJJJEIKLJGHBGFB	NM:i:0	AS:i:79	XS:i:19
HWI-ST430:177:2:1:4979:15503#0	129	chr5	36697147	60	72M28S	chr32	26100696	0	ATTTGCCCCTGGGCTATTTTTTTCCTNCCATGTAAGATTCCGTTTTAAAAATGTTTCCAGTGTTCTGTTGTTTTTATTATTGTTTTTGTAAATTTTAGGC	===<=<<<<====<=>========<<!<<<=><<=>>>>>=5=>>>>>>>>>>=>>>==>=>=>>>>=?>=>>>>>>>>=?>=>>>?>>>??>??>;<=>	SA:Z:chr32,26100739,-,36M64S,60,0;	BD:Z:[email protected][email protected]@@EGGEGGGFHAAAHGJHBJJDDEHHI	MD:Z:26T37T7	PG:Z:MarkDuplicates	RG:Z:Basenji	BI:Z:FFFBHHHFFHGGDGHGGEAAAAADFGEEEIHHGHFFFGFEGHHFBBGFBBBGHGFBEGIIIFGFEFHGFHHGCCCHIGHIGHHGDDDIIKIFKJGHGHGH	NM:i:2	AS:i:65	XS:i:21
HWI-ST430:177:2:1:4979:15503#0	401	chr32	26100739	60	36M64H	=	26100696	-79	GCCTAAAATTTACAAAAACAATAATAAAAACAACAG	===<=>>=>>===>===<=>===========>;===	SA:Z:chr5,36697147,+,72M28S,60,2;	BD:Z:[email protected]@AHHIJFIFF	MD:Z:36	PG:Z:MarkDuplicates	RG:Z:Basenji	BI:Z:HGHGBBFFAEGFFAAAEFFEGFEGFABBFGHGGHFF	NM:i:0	AS:i:36	XS:i:22
The BAM file is alignment of HiSeq reads aligned to the reference genome using bwa, and use picard to remove redundancy. Base realignments were done using gatk.


My confusion is:
1、Why there are three reads with the same name, but have no relation?
2、Maybe the first two are treated as mate pairs and the third as a single read. So could I just ignore it?

Could eveyone help me? Many thanks for your help!
Alphabets is offline   Reply With Quote