the format of output file of Maq

[zcrself]

HWI-EAS-249_42:1:1:10:282#0/2	chromosome01	8649295	-	0	0	0	0	0	11	20	0	12	76	aattccaaggagcctgcttgacctgtgtttcgtctgaacttcaaccctcctcgatgctgcttctctaagctgaacT	########################################!############################;4864:A
HWI-EAS-249_42:1:1:10:1227#0/2	chromosome01	8757671	-	0	0	19	19	19	10	25	0	0	76	gagtcgttaaaaaaaatctatttcttagggttatttcttgggggacggaagattatactccccccgtcctataatA	#########################################9;9(;779479(949(9;98;;8;78679696;9B
HWI-EAS-249_42:1:1:12:1701#0/2	chromosome01	11998357	+	0	0	19	19	19	15	36	0	0	76	CaacGGattggctggtgacaccgatatctgactttatggctcgcgcctgtggtgggacccagcgtcgtgggcgggg	B55,??335###################################################################
HWI-EAS-249_42:1:1:11:1076#0/2	chromosome01	12313108	-	0	0	6	6	6	6	10	0	0	76	aaatcagcttcccaagatgtcgtacccccagaatggtcataatttacggatgttctcatttcattaacaaaaCCtT	##########################################!#############################@?0?
HWI-EAS-249_42:1:1:11:637#0/2	chromosome01	13502430	+	0	0	19	19	19	6	12	0	0	76	cggatttaattggatagatatatctatacggttaaacttgagtgcaggacctccgactggttcacctatacgcact	############################################################################

this file was produced by Maq-0.7.1
what means of every columns?

[zcrself]

the format of map which is produced by Maq

read name, chromosome, position, strand, insert size from the outer coorniates of a pair, paired flag, mapping quality, single-end mapping quality, alternative mapping quality, number of mismatches of the best hit, sum of qualities of mismatched bases of the best hit, number of 0-mismatch hits of the first 24bp, number of 1-mismatch hits of the first 24bp on the reference, length of the read, read sequence and its quality

[nilshomer]

read name, chromosome, position, strand, insert size from the outer coorniates of a pair, paired flag, mapping quality, single-end mapping quality, alternative mapping quality, number of mismatches of the best hit, sum of qualities of mismatched bases of the best hit, number of 0-mismatch hits of the first 24bp, number of 1-mismatch hits of the first 24bp on the reference, length of the read, read sequence and its quality

See:

http://maq.sourceforge.net/maq-manpage.shtml

http://maq.sourceforge.net/maqmap_format.shtml