View Single Post
Old 06-02-2014, 02:50 AM   #53
Thias
Member
 
Location: Münster, Germany

Join Date: Mar 2013
Posts: 42
Default

Hello Brian,

I need someone to give me a broad hint. I have already successfully indexed some eukaryotic genomes with BBMAP. But one PhD student in our lab has sequenced a custom shRNA library and I just wanted to use my usual aligner and just lower k-mer size. But it claims that it cannot read the FASTA with the reference sequences, although it is there. It there a lower limit of scaffold sizes (or a special parameter which I didn't set) which may cause BBMAP to abort with that error or is really the FASTA file somehow corrupted?

Code:
java -da -Xmx32g -cp /home/z/zepper/software/bbmap/current/ align2.BBMap build=1 overwrite=true match=long fastareadlen=500 ref=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa path=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/bbmap_index build=1 threads=4 -Xmx32g midpad=2000 k=5 minscaf=5
Executing align2.BBMap [build=1, overwrite=true, match=long, fastareadlen=500, ref=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa, path=/mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/bbmap_index, build=1, threads=4, -Xmx32g, midpad=2000, k=5, minscaf=5]

BBMap version 31.56
Set OVERWRITE to true
Cigar strings enabled.
Set threads to 4
Retaining first best site only for ambiguous mappings.
No output file.
Exception in thread "main" java.lang.RuntimeException: Cannot read file /mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa
        at align2.RefToIndex.makeIndex(RefToIndex.java:28)
        at align2.BBMap.setup(BBMap.java:238)
        at align2.AbstractMapper.<init>(AbstractMapper.java:56)
        at align2.BBMap.<init>(BBMap.java:39)
        at align2.BBMap.main(BBMap.java:28)
[zepper@zivsmp001 Pia]$ head /mnt/HPC/zepper-tmp/Pia/reference/sh_sequences/shRNAs.fa
>Acta1_Mmi503488
TGCTGTACAGGTCCTTCCTGATGTCGGTTTTGGCCACTGACTGACCGACATCAAAGGACCTGTA
>Acta1_Mmi503489
TGCTGTCTGCATGCGGTCAGCGATACGTTTTGGCCACTGACTGACGTATCGCTCCGCATGCAGA
>Acta1_Mmi503490
TGCTGAAGAGCGGTGGTCTCGTCTTCGTTTTGGCCACTGACTGACGAAGACGACCACCGCTCTT
>Ahr_Mmi503972
TGCTGATTACAGGGAGCAAAGTTCTGGTTTTGGCCACTGACTGACCAGAACTTCTCCCTGTAAT
>Ahr_Mmi503973
TGCTGTATGGATGAGCTCATATACGCGTTTTGGCCACTGACTGACGCGTATATGCTCATCCATA
Thias is offline   Reply With Quote