View Single Post
Old 08-12-2010, 10:53 AM   #16
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,165
Default

Quote:
Originally Posted by proteasome
Debabrata:

For current "Titanium" reagents the adapter sequences are:

A: CGTATCGCCTCCCTCGCGCCATCAG
B: CTATGCGCCTTGCCAGCCCGCTCAG


Simon
Quote:
Originally Posted by pmiguel View Post
Simon,

Where did you get these? They do not the match the Lib-L Titanium adaptor sequences I have seen.

Phillip
These are the Amplicon primer sequences. If you use these sequences you would need to use the Lib-A emulsion kit
kmcarr is offline   Reply With Quote