View Single Post
Old 04-30-2015, 04:55 PM   #1
arkilis
Senior Member
 
Location: Australia

Join Date: Jul 2013
Posts: 119
Default using primer3+ design primers received a warning?

When I use primer3+ to do the primer design. It gives out a warning:

Checking for poly-A and poly-T regions >= 7 bp, and potential hairpins ( >= 85% GC in a 30 bp window):

Amplimer 1: Poly-A region in amplimer TTGGAGGAAGATGCTTAGCC[...]GGTTAATGAAGTGTGGAGACTCC

What does this mean? Thanks
arkilis is offline   Reply With Quote