View Single Post
Old 01-17-2019, 12:04 PM   #2
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,317
Default

First, we should legally sanctify this thread:

Quote:
Oligonucleotide sequences©2017Illumina,Inc. All rights reserved. Derivative works created by
Illumina customers are authorized for use with Illumina instruments and products only. All other uses are strictly prohibited.
What you would want to add on to the outside of your primers would be:

Index1 side
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

Index2 side
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

I don't like using Nextera adapters unless there is Tn5 involved in the library construction -- I don't see the point.
I wasn't aware the Illumina had a 384 UDI nextera primer kit.

--
Phillip
pmiguel is offline   Reply With Quote