View Single Post
Old 10-24-2019, 08:19 AM   #1
radood
Junior Member
 
Location: USA

Join Date: Oct 2019
Posts: 4
Question Wrong bwa alignment?

Hi,
Below is a supplementary alignment for one of my reads with a mapping quality score of 43.This should map to chr2: 29446797 in hg19

03012p9SX:030B 2064 1 29446797 43 36M241H -1 -1 36 CCCCACGTGAACGAGGGAGGGAGGGAGGGTTGGGTG array('B', [32, 37, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 41, 37, 41, 41, 41, 41, 41, 41, 41, 41, 37, 41, 41]) [('SA', 'chr2,42479618,+,238M39S,60,2;'), ('MD', '26A9'), ('RG', 'SAMPLE.sample23'), ('NM', 1), ('AS', 31), ('XS', 23), ('fm', '3_0')]

Since the read is on the negative strand, below is the forward sequence:
CACCCAACCCTCCCTCCCTCCCTCGTTCACGTGGGG

However this sequence does not map to chr2: 29446797. I tried blasting but I think it is too short so I aligned it to the genomic sequence as you can see here
https://ibb.co/R7VHrQH
This is not a good alignment at all. Is BWA wrong? Am I missing something?
Thank you for your input in advance!
radood is offline   Reply With Quote