View Single Post
Old 11-20-2019, 02:29 PM   #2
cmbetts
Senior Member
 
Location: Bay Area

Join Date: Jun 2012
Posts: 114
Default

I take it these are NextSeq or NovaSeq?

This is an adapter dimer that's read through the p7 sequence (ATCTCGTATGCCGTCTTCTGCTTG) into the FC and started spitting out Gs because no template = no signal = G in 2 color chemistry
cmbetts is offline   Reply With Quote