View Single Post
Old 03-03-2020, 07:11 AM   #2
Rnasoup
Junior Member
 
Location: Spain

Join Date: Feb 2020
Posts: 2
Default

Probably is a bit late for you, but I hope this may help other people. I struggled to find out the sequences to trim adapters from BGI/MGI sequencing data. At the end, I found a pdf with the oligos used for library prep

Normally I use grep to inspect the adapters, but with BGI/MGI it was confusing because I found that there are often mutations in the adapters (I rarely see it when looking Illumina data).

In short, for paired-end, this cutadapt command found adapters in around 10% of the read pairs in this dataset.

Code:
cutadapt -a AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA -A AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG
Rnasoup is offline   Reply With Quote