View Single Post
Old 08-27-2012, 01:46 PM   #1
rndouglas
Member
 
Location: USA

Join Date: Jun 2012
Posts: 23
Default SAM to BAM conversion issue

All of a sudden a problem with SAM to BAM conversion has cropped up for me.

I used Bowtie 1 to map sRNA reads to a sequence of interested and had a SAM file outputted:

Code:
@HD	VN:1.0	SO:unsorted
@SQ	SN:centc	LN:11067
@PG	ID:Bowtie	VN:0.12.8	CL:"bowtie -f -S --al /Users/birchlerlab/Desktop/TB9Sb1_centc_aligned.fa /Users/birchlerlab/Desktop/maize_centromeres/centc.fa /Users/birchlerlab/Desktop/TB9SB1_filtered_18_28nt.fa"
CTATAAGTCTGTGAAGGTGTCTT	4	*	0	0	*	*	0	0	CTATAAGTCTGTGAAGGTGTCTT	IIIIIIIIIIIIIIIIIIIIIII	XM:i:0
AAGGGGTCGACACAGTTTAGCATG	4	*	0	0	*	*	0	0	AAGGGGTCGACACAGTTTAGCATG	IIIIIIIIIIIIIIIIIIIIIIII	XM:i:0
CCTTCTATCGACGGAGCAGGACGCC	4	*	0	0	*	*	0	0	CCTTCTATCGACGGAGCAGGACGCC	IIIIIIIIIIIIIIIIIIIIIIIII	XM:i:0
CATAACGAAGAAACCCTAGCCT	4	*	0	0	*	*	0	0	CATAACGAAGAAACCCTAGCCT	IIIIIIIIIIIIIIIIIIIIII	XM:i:0
ATGAATGTAGATGAAGGGAACTCA	4	*	0	0	*	*	0	0	ATGAATGTAGATGAAGGGAACTCA	IIIIIIIIIIIIIIIIIIIIIIII	XM:i:0
GAGGATAGCCAAGAGTTCAGGGCC	4	*	0	0	*	*	0	0	GAGGATAGCCAAGAGTTCAGGGCC	IIIIIIIIIIIIIIIIIIIIIIII	XM:i:0
GTGAGTTGAGAATCCATGCGGGCG	4	*	0	0	*	*	0	0	GTGAGTTGAGAATCCATGCGGGCG	IIIIIIIIIIIIIIIIIIIIIIII	XM:i:0
GTGAGTTGAGAATCCATGCGGGCG	4	*	0	0	*	*	0	0	GTGAGTTGAGAATCCATGCGGGCG	IIIIIIIIIIIIIIIIIIIIIIII	XM:i:0
AAGGAGAGTAAGAATTAACAGTGT	4	*	0	0	*	*	0	0	AAGGAGAGTAAGAATTAACAGTGT	IIIIIIIIIIIIIIIIIIIIIIII	XM:i:0
AAGGAGAGTAAGAATTAACAGTGT	4	*	0	0	*	*	0	0	AAGGAGAGTAAGAATTAACAGTGT	IIIIIIIIIIIIIIIIIIIIIIII	XM:i:0
Everything seemed okay at that point, and I wanted to throw the output into IGV to visualize the reads when it yelled at me (rightfully so) that my SAM file was unsorted.

Aha! I thought I would just convert to BAM then sort, then go back to IGV.

So I used this to convert SAM to BAM:

Code:
samtools view -bS ~/TB9SB3.sam > ~/TB9SB3.bam
Then I went to sort the file and it finished instantly. I knew something was not right so I looked at my BAM file and it looked like garbled trash (see photo from a related sample).



Any suggestions on what I might have done to screw things up? I have installed nothing/deleted nothing since my SAM to BAM conversions were working well last week.
My previous SAM to BAM converstions were with Tophat output though. Does Bowtie output not do well with a conversion?
rndouglas is offline   Reply With Quote