@dpryan: thanks for the reply!
Yes, I used tophat-fusion, so this means that the counts I get from these alignments are unreliable?
Also, I am using dexseq_count.py on my 105 RNA-Seq samples, and only one of the files triggered an error:
ValueError: ("unsupported format character ''' (0x27) at index 34", 'line 433369370
And this is the line:
SRR391511.sra.ncbi_enc.52549224 163 chr3 49396810 50 50M = 49396966 205 GGGAAACCAATTCCTATTTACTTAGCCCAGCTCCATGGGGTACTGAGATA B*CBABA><7ABB6BACAA>;AB@B@?ABB@@A?=AB<<6-?>BB>A>6@ XA:i:1 MD:Z:1T48 N@BAA=?9:@4@ XA:i:0 MD:Z:50 NM:i:0 XS:A:- XP:Z:chr3 49397428 50M NH:i:1
Is there something I should fix in that line to make it work? Also, it would be good to know why it is only failing with that one file when all of them have been processed the same way. Thanks for any input in the matter.
Yes, I used tophat-fusion, so this means that the counts I get from these alignments are unreliable?
Also, I am using dexseq_count.py on my 105 RNA-Seq samples, and only one of the files triggered an error:
ValueError: ("unsupported format character ''' (0x27) at index 34", 'line 433369370
And this is the line:
SRR391511.sra.ncbi_enc.52549224 163 chr3 49396810 50 50M = 49396966 205 GGGAAACCAATTCCTATTTACTTAGCCCAGCTCCATGGGGTACTGAGATA B*CBABA><7ABB6BACAA>;AB@B@?ABB@@A?=AB<<6-?>BB>A>6@ XA:i:1 MD:Z:1T48 N@BAA=?9:@4@ XA:i:0 MD:Z:50 NM:i:0 XS:A:- XP:Z:chr3 49397428 50M NH:i:1
Is there something I should fix in that line to make it work? Also, it would be good to know why it is only failing with that one file when all of them have been processed the same way. Thanks for any input in the matter.
Comment