View Single Post
Old 03-24-2018, 05:06 PM   #3
fgilpara
Member
 
Location: Barcelona

Join Date: Oct 2017
Posts: 10
Default

1 PCR to add adapters and 1 index. Forward common, reverse different index.


AATGATACGGCGACCACCGA
Adapter P5

GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTAGCTAGC
RD1

TTGGGCTCCTGTCTTACAGGC
gene specific primer 5

CCTGCCTCCGGGCTCACCTCGCTGTGACCT Amplified sequence

GAAGGAGAATCTGCTGAAGGATAACT
gene specific primer 5

GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Primer RD2

XXXXXX
Index

ATCTCGTATGCCGTCTTCTGCTTG
Adapter P7
fgilpara is offline   Reply With Quote