View Single Post
Old 03-25-2018, 02:21 PM   #11
fgilpara
Member
 
Location: Barcelona

Join Date: Oct 2017
Posts: 10
Smile

Quote:
Originally Posted by nucacidhunter View Post
It seems that your P7 adapter is missing an A at the start. The A is not part of adapter but it is added during A tailing in shotgun library prep. Since you are adding adapters as part of your GSP you should add the A, otherwise the fragments will be primed by truncated sequencing primers from multiple positions in a cluster which will result in low quality sequences.

I guess the other amplicon that sequences well accidentally has an A in that position which is part of your primer.

AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTAGCTTGGGCTCCTGTCTTACAGGCCCTGCCTCCGGGCTCACCTCGCTGTGACCTGAAGGAGAATCTGCTGAAGGATAACT


AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC GCCAAT ATCT CGTATGCCGTCTTCTGCTTG
I know my adapters are from an older version and i see the new ones have and aditional A like you say but i don't fully understand the problem you are trying to point out. Could you please elaborate or make a small pic? i thank you so much for helping me.
fgilpara is offline   Reply With Quote