View Single Post
Old 03-25-2018, 06:37 PM   #12
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,182
Default

I assume the sequences that you have provided represent top strand of amplicon if put together continuously as following.
Code:
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTAGCTTGGGCTCCTGTCTTACAGGCCCTGCCTCCGGGCTCACCTCGCTGTGACCTGAAGGAGAATCTGCTGAAGGATAACTGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
If it is sequenced to the end should give following R1 sequence:
Code:
TAGCTTGGGCTCCTGTCTTACAGGCCCTGCCTCCGGGCTCACCTCGCTGTGACCTGAAGGAGAATCTGCTGAAGGATAACTGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG
It seems that sequences that you have provided in posts above is not representing your actual amplicon sequence. A typical sequence from your sequence file is as following (I have trimmed sequences after end of adapter which includes polyA and some other background signal):

Code:
TAGCTTGGGCTCCTGTCTTACAGGCCCTGCCTCCGGGCTCACCTCGCTGTGACGCTCGGACGAGCACACGTCTGAACTCCAGTCACATGCGCATCTCGTATGCCGTCTTCTGCTTG
For your information, the A is the base complementary to the most 3’ base of sequencing primer. Please look at page 2 of attached HT adapters where non-adapter A added during A tailing of shotgun library prep is shown. These adapters are only different from LT adapters in index and have few extra bases that are not part of R1 or R2 sequencing primers. Sequencing primer have a T at 3’ end which pairs with that A and if A is absent then it cannot be extended during sequencing. R2 sequences then will be read by truncated R2 sequencing primer resulting in erroneous and low quality bases. This is R2 sequencing primer: 5’ GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT and note the 3’ T.
Attached Files
File Type: pdf TruSeq HT Adapter structure.pdf (308.0 KB, 11 views)

Last edited by nucacidhunter; 03-26-2018 at 01:51 PM. Reason: Corrected some factual error from original post.
nucacidhunter is offline   Reply With Quote