View Single Post
Old 09-26-2013, 10:29 PM   #1
garethboy
Member
 
Location: Kuala Lumpur

Join Date: Feb 2012
Posts: 19
Default problem with adding numerical sequence at the end of line

Hi,

Anyone has any idea how to get this:

>no_name
TATGCATCGATGCACATATGCTAGTGCGCTAGTGTCGAGGCTAGCTACG
>no_name
GACGTACGTAGCATGCATGCATGCGTAGCTGTAGCTAGC
>no_name
GCTAGCTAGGTAGGTCATGTAGTAGGTGCACTGAGCTAGCTAGCTAGCTAGCAGC
>no_name
GCTAGCATGCTAGCTAGCTAGCACTAGCTAGCTAGCTAGCTAATGCATCATC
>no_name
GCTACGTAGCATGCTAGCGGATCATGCATGCATGCTAGCATCGATGCTAGCATGCAT

become this:

>no_name_1
TATGCATCGATGCACATATGCTAGTGCGCTAGTGTCGAGGCTAGCTACG
>no_name_2
GACGTACGTAGCATGCATGCATGCGTAGCTGTAGCTAGC
>no_name_3
GCTAGCTAGGTAGGTCATGTAGTAGGTGCACTGAGCTAGCTAGCTAGCTAGCAGC
>no_name_4
GCTAGCATGCTAGCTAGCTAGCACTAGCTAGCTAGCTAGCTAATGCATCATC
>no_name_5
GCTACGTAGCATGCTAGCGGATCATGCATGCATGCTAGCATCGATGCTAGCATGCAT
garethboy is offline   Reply With Quote