View Single Post
Old 05-16-2013, 01:08 PM   #6
illuminaGA
Member
 
Location: Atlanta

Join Date: Dec 2012
Posts: 70
Default

Quote:
Originally Posted by GenoMax View Post
This would be a good case where you should contact Illumina tech support so you can get comprehensive help from them.

As I had said before one obvious thing to try would be to load less DNA next time (you did not say what your original cluster counts were). If overloading was not the problem (if the total cluster counts were within limits) then perhaps something else has gone wrong with the tag read/libraries.

You should contact Illumina support (or your local FAS) since your original post seems to indicate that this has been a repeat problem.
Hello GenoMax

I sent all may SAV file to illumina techsupport ,after analyzed my data,they said that "HP8 did not hybridize with those IDT sample preps. The intensity readings of index 1 is nearly zero, which accounts for not seeing index counts in your results. Since the index 1 worked in the other lanes, it is likely not a index primer fluidics issue on the instrument. This would also confirm the effectiveness of the HP8 primer in the system."

I used IDT Y shape TruSeq dup Adapter for my libraries preparation. The sequence of the adapter as follow.

TruSeq Universal Adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC-GCTCTTCCGA TC *T-3


TruSeq Indexed Adapter
GTTCGTCTTCTGCCGTATGCTCTA-NNNNNN-CACTGACCTCAAGTCTGCACA-CGAGAAGGCTAG*P-5


I ordered TruSeq SBS Kit v5 - GA (36-cycle)(FC-104-5001) for our GA IIx and TruSeq PE Cluster Kit v2(PE-300-2001) for cBot.

Did I make mistake about my adapters?

Thanks
illuminaGA is offline   Reply With Quote