View Single Post
Old 12-05-2013, 04:50 AM   #2
dariober
Senior Member
 
Location: Cambridge, UK

Join Date: May 2010
Posts: 311
Default

Hi johanneskoester,

I'm curious about learning more about snakemake, thanks for positing it!

I'm quite familiar with python, R, bash but I'm not familiar at all with GNU Make and friends (other than executing it when I get some source code). So I must admit I fail to see where the advantage comes when building bioinformatics pipelines.

For example, following this example on snakemake, this is how I would implement the same pipeline:

Code:
REF="/global/home/users/ebolotin/scratch/hg19/hg19"
for fq in *.fastq.gz
do
    bname=`basename $fq .fastq.gz`
    ## Prepare pipeline
    echo "cutadapt  -m 10 -a AGATCGGAAGAGCACACGTCTGAACTCC -o ${bname}.cut $fq &&
    bowtie2 -p 20 --very-sensitive -x $REF -U ${bname}.cut -S ${bname}.sam &&
    makeTagDirectory ${bname}.tag ${bname}.sam -keepAll -genome hg19" > ${bname}.sh
    ## Run the job:
    bash ${bname}.sh
    # OR
    # nohup ${bname}.sh &
    # OR
    # bsub [opts] < ${bname}.sh
done
Could you point out in what respect snakemake would make it preferable?

Thanks!
Dario
dariober is offline   Reply With Quote