View Single Post
Old 04-01-2019, 06:17 PM   #668
seqmore
Junior Member
 
Location: china

Join Date: Apr 2019
Posts: 4
Default RNAseq data analysis failed with BBMAP

Dear Brain,

BBMAP is great for mapping coverage and mapping speed. I have tried several times but failed. The versions of bbmap and samtools are 38.22 and 0.1.9, respectively. My data is RNA seq generated using human cell lines. The command lines and output are listed below:

bbmap.sh ref=Homo_sapiens.GRCh38.dna.primary_assembly.fa

$bbmap.sh maxindel=200k intronlen=20 ambig=all xstag=unstranded xmtag=t in=a.fq out=a.bbmap.sam outu=a.unbbmap.fq bs=script.sh

## a.fq has been trimmed using trim-galore and dynamictrim. The sequencer is illumila hiseq.

$samtools flagstat a.bbmap.sam
[bam_header_read] EOF marker is absent.
[bam_header_read] invalid BAM binary header (this is not a BAM file).
[bam_flagstat_core] Truncated file? Continue anyway.
0 in total
0 QC failure
0 duplicates
0 mapped (-nan%)
0 paired in sequencing
0 read1
0 read2
0 properly paired (-nan%)
0 with itself and mate mapped
0 singletons (-nan%)
0 with mate mapped to a different chr
0 with mate mapped to a different chr (mapQ>=5)


$more a.bbmap.sam
@HD VN:1.4 SO:unsorted
@SQ SN:1 dna:chromosome chromosome:GRCh38:1:1:248956422:1 REF LN:248956422
@SQ SN:10 dna:chromosome chromosome:GRCh38:10:1:133797422:1 REF LN:133797422
@SQ SN:11 dna:chromosome chromosome:GRCh38:11:1:135086622:1 REF LN:135086622
@SQ SN:12 dna:chromosome chromosome:GRCh38:12:1:133275309:1 REF LN:133275309
@SQ SN:13 dna:chromosome chromosome:GRCh38:13:1:114364328:1 REF LN:114364328
@SQ SN:14 dna:chromosome chromosome:GRCh38:14:1:107043718:1 REF LN:107043718
@SQ SN:15 dna:chromosome chromosome:GRCh38:15:1:101991189:1 REF LN:101991189
@SQ SN:16 dna:chromosome chromosome:GRCh38:16:1:90338345:1 REF LN:90338345
.......................
......................[omit other lines]
@PG ID:BBMap PN:BBMap VN:38.22 CL:java -Djava.library.path=/path/bbmap-38.22-1/jni/ -ea -Xmx158342m align2.BBMap
build=1 overwrite=true fastareadlen=500 maxindel=200k intronlen=20 ambig=all xstag=unstranded xmtag=t in=a.fq out=a.bbmap.sam outu=a.unbbma
p.fq bs=script.sh
E00603:213:HVLFGCCXY:1:1101:20172:9431 1:N:0:ACGGAACA 16 5 dna:chromosome chromosome:GRCh38:5:1:181538259:1 REF 14481853 42 44= * 0 0 CAGAAACAAGCAGGACCGGGCTTTGTCTCTTGGGCCCAGTACTG FA<JJJAJJJAJFA7FJJJJFJFJJJJJFJJJJF7JJFJJJFFF NM:i:0 AM:i:42 XM:i:1 NH:i:1
E00603:213:HVLFGCCXY:1:1101:17056:10081 1:N:0:ACGGAACA 4 * 0 0 * * 0 0 AAGCAAGTCTTTATCTTTAGAATAAATGTAGT JJJJ7FAFFFFJJJJJAJJJJJJJJJJJJJ77
.......................
......................[omit other lines]


$sh script.sh
Note: This script is designed to run with the amount of memory detected by BBMap.
If Samtools crashes, please ensure you are running on the same platform as BBMap,
or reduce Samtools' memory setting (the -m flag).
Note: Please ignore any warnings about 'EOF marker is absent'; this is a bug in samtools that occurs when using piped input.
[samopen] SAM header is present: 194 sequences.
sort: invalid option -- '@'
Parse error at line 197: invalid CIGAR character
open: No such file or directory
Aborted (core dumped)
[bam_sort_core] fail to open file 3
open: No such file or directory
[bam_index_build2] fail to open the BAM file.


Could you give some suggestions? Thanks a lot.
seqmore is offline   Reply With Quote