View Single Post
Old 04-10-2008, 04:37 AM   #3
horigen
Junior Member
 
Location: Hefei, China

Join Date: Feb 2008
Posts: 6
Default

Very useful!
I refined these sequences. Hopes they're clearer.


Genomic DNA

Adapter:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------- 5'
Adapter:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCTCGTATG CCGTCTTCTGCTTG 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
PCR Primer:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------- 5'
PCR Primer:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------- 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
Result Library:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCTCGTATG CCGTCTTCTGCTTG 3'
3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
Genomic DNA Sequencing Primer:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------- 5'

DpnII gene expression

Gex Adapter 1:
5' -------------------A CAGGTTCAGAGTTCTACAGT CCGAC--------------- -------------------- ------ 3'
3' -------------------- ---CAAGTCTCAAGATGTCA GGCTGCTAGp---------- -------------------- ------ 5'
Gex Adapter 2:
5' -------------------- -------------------- -------------------- ----pTCGTATGCCGTCTTC TGCTTG 3'
3' -------------------- -------------------- -------------------- ---NNAGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 1:
5' -------------------- -------------------- ----------------------------------------- ------ 3'
3' -------------------- -------------------- -------------------- -----AGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 2:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA---------------- -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -------------------- ------ 5'
Result Library:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACGATCNNNNNNNNNNN NNNNNTCGTATGCCGTCTTC TGCTTG 3'
3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGCTAGNNNNNNNNNNN NNNNNAGCATACGGCAGAAG ACGAAC 5'
Gex Sequencing Primer:
5' -----------------CGA CAGGTTCAGAGTTCTACAGT CCGACGATC----------- -------------------- ------ 3'
3'--------------------- -------------------- -------------------- -------------------- ------ 5'

NlaIII gene expression

Gex Adapter 1:
5' -------------------A CAGGTTCAGAGTTCTACAGT CCGACATG------------ -------------------- ------ 3'
3' -------------------- ---CAAGTCTCAAGATGTCA GGCTp--------------- -------------------- ------ 5'
Gex Adapter 2:
5' -------------------- -------------------- -------------------- ----pTCGTATGCCGTCTTC TGCTTG 3'
3' -------------------- -------------------- -------------------- ---NNAGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 1:
5' -------------------- -------------------- -------------------- -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -----AGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 2:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA---------------- -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -------------------- ------ 5'
Result Library:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACATGNNNNNNNNNNNN NNNNNTCGTATGCCGTCTTC TGCTTG 3'
3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGTACNNNNNNNNNNNN NNNNNAGCATACGGCAGAAG ACGAAC 5'
Gex Sequencing Primer:
5' ----------------CCGA CAGGTTCAGAGTTCTACAGT CCGACATG------------ -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -------------------- ------ 5'

Small RNA

5' RNA Adapter:
5' -------------------- ---GUUCAGAGUUCUACAGU CCGACGAUC (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'
3' RNA Adapter:
5' -------------------- -------------------- --------- (-)pUCGUAUGCCGUCUUCUGCUU GUidT 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'
RT Primer:
5' -------------------- -------------------- --------- (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) AGCATACGGCAGAAGACGAA C 5'
Small RNA PCR Primer 1:
5' -------------------- -------------------- --------- (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) AGCATACGGCAGAAGACGAA C 5'
Small RNA PCR Primer 2:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA----- (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'
Result Library:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGACGATC (N) TCGTATGCCGTCTTCTGCTT G 3'
3' TTACTATGCCGCTGGTGGCT GTCCAAGTCTCAAGATGTCA GGCTGCTAG (N) AGCATACGGCAGAAGACGAA C 5'
Small RNA Sequencing Primer:
5' -----------------CGA CAGGTTCAGAGTTCTACAGT CCGACGATC (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'


Two errors have been corrected. (Genomic DNA Adapter & Small RNA Result Library)
I'm sorry for that and other potential errors.

Last edited by ECO; 10-03-2008 at 06:34 AM. Reason: changed font to courier new
horigen is offline   Reply With Quote