View Single Post
Old 12-24-2013, 10:47 PM   #1
krispy
Junior Member
 
Location: Singapore

Join Date: Apr 2013
Posts: 7
Default MiSeq Index Primer Sequence

Hi all,

I am looking for the exact sequence for the default MiSeq Index Primer. Can anyone help me to check if this is the correct one?

5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

and probably provide me if there is any reliable source where Illumina confirms this is the correct sequence?

Thank you very much.
Merry Christmas.
krispy is offline   Reply With Quote