View Single Post
Old 07-12-2012, 09:08 AM   #1
ajgentles
Junior Member
 
Location: Planet Earth

Join Date: Jun 2011
Posts: 4
Default tophat2/samtools

We have been trying to move from tophat1 to tophat2 utilizing a transcriptome as well as genome reference, and are having some performance and output issues. RNA-seq data that previously took about 12 hours to map now takes >4 days (stopped the runs at that point), with tophat_reports apparently being the culprit. Providing just a few hundred reads still takes much longer than expected and ends with an error in tophat_reports. The reported error is typically something like

Warning: mapped sequence without CIGAR (DJG84KN1:201:C0CKNACXX:7:1101:1815:2215)
Warning: mapped sequence without CIGAR (DJG84KN1:201:C0CKNACXX:7:1101:1815:2215)
Warning: mapped sequence without CIGAR (DJG84KN1:201:C0CKNACXX:7:1101:2101:2179)
Warning: mapped sequence without CIGAR (DJG84KN1:201:C0CKNACXX:7:1101:2101:2179)
Warning: mapped sequence without CIGAR (DJG84KN1:201:C0CKNACXX:7:1101:2307:2249)
Warning: mapped sequence without CIGAR (DJG84KN1:201:C0CKNACXX:7:1101:2307:2249)
Error: CIGAR and sequence length are inconsistent!(TGCTCTTCCGATCTGCCCCCTTAAACACCATTTTCCCTCCAGGACCACCTTGGTTTCTAGGCACTGTGGTTCTTGGCAGGGGCTGTCTTAGG)

This looks like it's possibly an incompatibility with samtools but we have tried versions 0.11 through 0.18 with no change. I wondered if anyone can help narrow down the issue ?
ajgentles is offline   Reply With Quote