View Single Post
Old 11-07-2012, 11:37 PM   #2
kristofit
Junior Member
 
Location: france

Join Date: Apr 2012
Posts: 3
Default

Hi,

I got the same problem using tophat 2.0.6. (and bowtie 2.0.2) and can not find a way to solve the problem.
- error log is:
Error running /PATH/tophat.dir/bin/tophat_reports
Error: CIGAR and sequence length are inconsistent!(TTCAAACAAAATCGAATCCTGAAAGAGTAGAAGGGGAGCGGTGAGAGGAGGAGGAGGAGGAAGAGGAGGAGGGGGGCAGTCCTCCCCGAGCTAAAAACCTC)
Somebody did solve this problem ?
kristofit is offline   Reply With Quote