Hi, all
Every now and then when I am trying to convert .sam file into .bam file by calling
, I get this kind of error:
I'm pretty sure that the xxx.sam file is readable and in the working directory, and the header is like this:
In contrast, I did successfully convert some other .sam file into .bam file and the header looks exactly the same of the above one. The only difference maybe the file size. The above .sam file is very big (10GB), but however I have sufficient memory to load it (>250GB memory). So, It is quite confusing to me that I always get some error like this, I was trying to understand the C code of sam.C but I couldn't figure out what's the problem, can anyone help me? Thanks a lot!
Every now and then when I am trying to convert .sam file into .bam file by calling
Code:
samtools view -bT hg.fa -o xxx.bam xxx.sam
Code:
[main_samview] fail to open file for reading.
Code:
@HD VN:1.0 SO:sorted @PG ID:TopHat VN:1.0.13 CL:/scratch/ngsvin/ruping/CancerGenomics/tophat-1.0.13/bin/tophat -o /scratch/ngsvin/RNA-seq/MPI-NF/mimik_pairend/ --solexa1.3-quals -p 5 -r 46 --mate-std-dev 14 --segment-length 20 -G /scratch/ngsvin/RNA-seq/MPI-NF/Hs.genes.gff /scratch/ngsvin/ruping/CancerGenomics/bowtie-0.12.5/indexes/hg18 s_4_1fq.chopped s_4_2fq.chopped Run0009Lane4Tile57x3887y5410Multi0 65 chr1 461 255 36M = 154912309 154911848 CTAACCCTGGCGGTACCCTCAGCCGGCCCGCCCGCC GGAEGGGGGFGGFGDGGGGG?FFFFGFGGGFGGGFG NM:i:1 Run0009Lane4Tile28x19254y9909Multi0 73 chr1 537 0 36M * 0 0 ACCACCGAAATCTGTGCAGAGGAGAACGCAGCTCCG CGGDGGGFGGFGGGGGFGGGGGGFGGGGEGGGGGGG NM:i:1 Run0009Lane4Tile119x16602y20937Multi0 161 chr1 2792 255 36M = 3160 403 CTACAAGCAGCAAACAGTCTGCATGGGTCATCCCCT FEFFFFEFFFFFFFFCFDFFEFAFFFFEFFEDFFED NM:i:0 Run0009Lane4Tile48x11762y17580Multi0 147 chr1 3112 255 36M = 3130 -17 TGCCAGCATAGTGCTCCTGGACCAGCGATACGCCCG EGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG NM:i:2 Run0009Lane4Tile24x15875y8494Multi0 83 chr1 3113 255 36M = 3120 -28 GCCAGCATAGTGCTCCTGGACCAGCGATACGCCCGG 3>:.@+,31@56/?50;>CBB0)6@766-67/6@77 NM:i:2
In contrast, I did successfully convert some other .sam file into .bam file and the header looks exactly the same of the above one. The only difference maybe the file size. The above .sam file is very big (10GB), but however I have sufficient memory to load it (>250GB memory). So, It is quite confusing to me that I always get some error like this, I was trying to understand the C code of sam.C but I couldn't figure out what's the problem, can anyone help me? Thanks a lot!
Comment