View Single Post
Old 10-23-2018, 05:18 PM   #1
SuzuBell
Member
 
Location: U.S.A

Join Date: Nov 2013
Posts: 20
Default Align unmapped reads to virus genomes

Hello,

I am trying to determine how much of the unmapped reads from a transcriptome study align to viruses. My procedure so far has been to:

1) Download the complete genome of a virus in FASTA format. Here is one example I used (https://www.ncbi.nlm.nih.gov/nuccore...1?report=fasta)

2) Take my RNA-seq fastq file and run GSNAP to align it to the reference of interest (honeybee genome).

3) Now I would like to use the .nomapping file that is output from GSNAP and see how many of its reads map to the virus FASTA file of interest.

The .nomapping file is in the below format:

HISEQ:596:HKK7FBCXX:2:2216:18465:100529 272 GroupUn3757 1317 3 6S94M * 0 0 AATGCAAAAAAATAATAAACAATGATTTTAATTTCAACGACGTAAATTTCCGAATTTTGGGTGCGAATGTAGATGACTTAATGAGAAACACTCGTTGCGG IHHC?HHHIIIIIIIIIIIIIIIHFEHG<IHHG<1HHHEIIHHIHHIHHIIIIH@IHGHHGIHHHHHIIIIIHHHHFGFGIIIIHIIIHIHGHHH?DDDD MD:Z:94 NH:i:2 HI:i:2 NM:i:0 SM:i:3 XQ:i:40 X2:i:40 XO:Z:UM XG:Z:ext

My main worries are:

1) What program/procedure would be most efficient for running step 3?
2) Does this pipeline somewhat make sense?

Last edited by SuzuBell; 10-23-2018 at 06:45 PM.
SuzuBell is offline   Reply With Quote