View Single Post
Old 09-29-2010, 06:05 AM   #1
scami
Member
 
Location: italy

Join Date: Sep 2010
Posts: 55
Default soap segmentation fault

Hi Guys

I am using soap aligner on fastaq files and I get a "segmentation fault" at the end of the process. The input files have been created by myself with a script that extracted the reads from an old alignment file and, for this reason I suspect that there may be some problem with them although at a first sight they look ok. The command I used is inside a file called "go" and is the following

Code:
./soap -D ./index/genome.fasta.index -a exp_47_s_A1.fastq  -b exp_47_s_A2.fastq -o paired_mapped_v2g3r1_1 -u unpaired_v2g3r1_1 -2 single_mapped_v2g3r1_1 -v 2 -g 3 -m 50 -x 400 -r 1 -t  -p 14

I get the following output:

Code:
Begin Program SOAPaligner/soap2
Wed Sep 29 15:34:14 2010
Reference: ./index/genome.fasta.index
Query File a: exp_47_s_A1.fastq
Query File b: exp_47_s_A2.fastq
Output File: paired_mapped_v2g3r1_1
             single_mapped_v2g3r1_1
             unpaired_v2g3r1_1
Load Index Table ...
lsLoad Index Table OK
Begin Alignment ...
 131072 ok    3.36 sec
..................................
..................................
24510464 ok    3.96 sec
24641536 ok    3.73 sec
24772608 ok    3.79 sec
24903680 ok    3.63 sec
25034752 ok    3.86 sec
./go: line 1: 25344 Segmentation fault
the last lines of my input files are
Code:
tail exp_47_s_A1.fastq 
+ILLUMINA-C3C24B_0047:1:120:18879:21119#0/1
abb\bb_]__]]]]]KKDOOWZWWWbbabbbbbbbbbbbbb_bbbOODDOOONNNb\bbba`]Xa`Ya^``_[bb
@ILLUMINA-C3C24B_0047:1:120:18877:8210#0/1
agcagatcatgtggtganggactcggctggtcacagtcaggctgtgagccgatggtttgcccctcccccagggat
+ILLUMINA-C3C24B_0047:1:120:18877:8210#0/1
bbbbbbbbbbbbbbb``F^`aaaaabbbbb_ba`baab_a``_`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@ILLUMINA-C3C24B_0047:1:120:18872:16339#0/1
CTTGAAAACCTAGAATCAACACAAAATGAAAAAAAAAAAAAGCCCAAAAAAATGGCTTCCAAACCAGAAAactga
+ILLUMINA-C3C24B_0047:1:120:18872:16339#0/1
bbbbbbbbbbbbabbbabb_bbbbbbbbbbbbbb______ZL_[]`_`__b]Y\`]\\`O^]]W^bVb]bBBBBB



tail exp_47_s_A2.fastq 
+ILLUMINA-C3C24B_0047:1:120:18879:21119#0/2
bb^bbbbbbbabbbbS^W[^bbb_bbbbbbVUFZVOIKKO[ZVXWLTWWTT^^^[]RRR__BBBBBBBBBBBBBB
@ILLUMINA-C3C24B_0047:1:120:18877:8210#0/2
GTATTATCTACTGTGAGAGGAGTTGAGATCCGATTGAGTCCCGAGAGTATCTgtcgcattctcgacatcccttcg
+ILLUMINA-C3C24B_0047:1:120:18877:8210#0/2
bbbbbbbbbbbbbbbbbbbbbbbbb_bbbbabbbbbbbc`c__ababab^U^BBBBBBBBBBBBBBBBBBBBBBB
@ILLUMINA-C3C24B_0047:1:120:18872:16339#0/2
CAAATATGCAGCTCAAATGTCATCCCTGCATGCTCTAATACCAATTGATGAACTTTTAaacgacataggatcaca
+ILLUMINA-C3C24B_0047:1:120:18872:16339#0/2
bbbbb`bbbbbbbbbbbbb_bbbbbbbbbb_b^]b`abb^bbb`aaa`^`aaU]^^a_BBBBBBBBBBBBBBBBB

It looks everything right to me...... any idea?

thanks a lot for helping
scami is offline   Reply With Quote