View Single Post
Old 03-15-2017, 09:18 AM   #1
LijunZ
Junior Member
 
Location: PA, USA

Join Date: Feb 2017
Posts: 5
Default How to extract subregions from Miseq 16srRNA data?

We did 2X300 pair end sequence with Miseq to cover V1-V3 regions of 16srRNA. We use primer 27F (AGAGTTTGATCATGGCTCAG) for V1, and position 534-518 R (ATTACCGCGGCTGCTGG) for V3 regions.

Now, if I want to check V1 region only, I extract the reads have 27F primer:

grep "AGAGTTTGATCATGGCTCAG" Read1
grep "AGAGTTTGATCATGGCTCAG" Read2

Then keep the first 92bp for both read1/read2 as V1 region.

My question, do I need to consider reverse complimentary seq for 27F primer for both pair end reads? Am I right to extract from both paired read with same primer? Why my left reads (with V1 primer) from above have lots of V3 primer (over 30%)?

Is there recommend way to extract subregion for this pair end sequence, i.e V1 or V3 only with known design primer?

Thanks

Last edited by LijunZ; 03-16-2017 at 07:19 AM.
LijunZ is offline   Reply With Quote