View Single Post
Old 06-04-2020, 03:56 AM   #1
Saurabh_Raj
Junior Member
 
Location: Leipzig

Join Date: May 2020
Posts: 2
Default Regeneration of Pair End MiSeq flowcell

Hi,
I am performing some high-throughput DNA-protein interactions (HiTS-FLIP) using a custom made TIRF microscope, where I image the sequenced MiSeq flowcell. My trouble is that I need to regenerate the dsDNA on the flow cell, which doesn't seem to happen. Here is a short protocol of what I am doing:
* Denature the flowcell with NaOH and wash with TE buffer
* Inject Read 2 sequencing primer. I have tried two primers for regeneration 1) 34bp long GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT that covers the whole Read2 region, and 2) GTGACTGGAGTTCAGACGTGT - 21bp long, that is outside the 13bp overlapping region of Read1 and Read2.
* The primers are then subjected to an annealing cycle where flowcell temperature is raised to 85C and then slowly brought to 40 C. At this point, all the excess primers are washed away.
* Then the primer is extended using Bst2.0 warmstart polymerase at 60C. I have also tested Klenow at 37C.
* After running the regeneration, I inject Read1 oligos labeled with Cy3 to check whether regeneration was successful or not.
The problem is, I do not see any difference in the intensity of Read1Cy3 oligo binding before and after dsDNA regeneration. This means that my regeneration is unsuccessful. I would appreciate if you have some inputs on the methodology.
Thanks!
Best regards,
Saurabh
Saurabh_Raj is offline   Reply With Quote