Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • low clustering and bad sequencing primer efficiency on NextSeq 500

    I got low clustering and very bad sequencing primer efficiency on NextSeq 500 run in my MIP project. The sequencing primers (read1, read2 and two index primers) are customized. We have tried either to spike our primer into illumina sequencing primer wells or add them into optional wells which are designed specifically for costumer specific primers. Both didn't give use any sequencing results. Do anyone have any suggestions ? thanks.

    Does any know what is typical Tm for sequencing primers from illumina ? Looks like our customer specific primers don't anneal to reads very well. Is there anything that I can do to improve it in our Nextseq 500 run ? Thank you in advance.
    Last edited by Johnwang; 09-02-2016, 06:45 AM.

  • #2
    Attached are the recommendations from Illumina, I believe people often use 5 degree higher Tms (using the default IDT oligoanalyzer calculations).
    Attached Files

    Comment


    • #3
      If you're still having the issue, send me a message; I had to do some dancing to get custom primers to work on the NextSeq and might be able to help out.

      Comment


      • #4
        Thank you. Here are primers used for MIP amplification and NextSeq.

        Example of amplicon amplified with P7 and P5 in primers respectively:

        REV_index6 CAAGCAGAAGACGGCATACGAGATCATGCCTAACACGCACGATCCGACGGTAGTGT
        Index 6
        FOR_index5 AATGATACGGCGACCACCGAGATCTACACACTGCATACATACGAGATCCGTAATCGGGAAGCTGAAG
        Index 5
        Custom primers used:
        MIP_SEQ_FOR CATACGAGATCCGTAATCGGGAAGCTGAAG
        MIP_SEQ_REV ACACTACCGTCGGATCGTGCGTGT
        SEQ_index7 ACACTACCGTCGGATCGTGCGTGT
        SEQ_index5 TTCAGCTTCCCGATTACGGATCTCGTATG

        Comment


        • #5
          Sorry it took me a few days to check back. I might have identified your problem, although it might also be colored by my own experiences.

          I have quite small-insert libraries, and while they are homemade, they come out looking like standard Illumina dual-sided barcoded libraries. The only real difference is that the main read is sequenced with the Small RNA Sequencing Primer (from Illumina), which has a Tm of about 69 C, while the other Read1 primers in Illumina's mix have Tms around 74 C. When I tried sequencing my libraries on the NextSeq, what I saw was two lanes of decent sequence and two lanes of all Gs. If you know the NextSeq, you know that all Gs means (basically) that the cluster didn't sequence. But the cluster itself DID demultiplex, so the two index reads were successful.

          I should point out here before someone asks - yes, I'd sequenced these libraries extensively on MiSeq and HiSeq prior to my NextSeq Adventures. I do a lot of sequencing! Anyhow, after a lot of back and forth with Illumina, we finally hit on the Tm of the Small RNA Sequencing Primer.

          I couldn't make the primer longer, because there wasn't any extra room, so instead, I added LNA bases to bring the Tm up to ~74 C. I added the LNA primer to the Read1 custom position, and out came some gorgeous sequencing.

          So...I quickly put your primer sequences through IDT's Tm calculator, and the Tms are pretty low. Can you increase them, either via length, or via LNAs, to nearer to 74?

          I may be off the mark here, so feel free to send more details back. But after my headache, I'd look at Tm first.

          Oh, and the other thing that might be helpful is to make sure that a "standard" library (you could use PhiX, in a pinch) DOES sequence well. I was lucky enough to have a very similar library that used the standard Read 1 primer, and that helped narrow down the issue.

          Comment


          • #6
            Hi Yepler, thanks for your response with suggestions. As you mentioned, my Tm is pretty low when you checked it on IDT oligo analyzer. I looked it on exiqon, it is close to 70C. I can do LNA to increase Tm of my sequencing primer up to ~74C based on the exiqon calculation, but will still be 65C on IDT. So assume, I just do LNA and trust Tm with exiqon. Any other suggestions? such as length of oligo and position of LNA. Thank you again.

            John

            Comment


            • #7
              I used the Read 1 Sequencing Primer from Illumina as a baseline for the Tm calculations ('cause yes, all calculators seem different!).

              There are now three LNA bases in my primer, in the middle of the primer, (in a pattern like this: LNA-base-base-LNA-base-base...). Don't put an LNA base at the 3' end as a "clamp" - that sounded like a good idea but ended up giving some very strange results.

              Hope that helps and good luck.

              Comment


              • #8
                Hi Yepler,
                Many thanks for your inform and suggestions. By the way, quick question for LNA oligos, is Standard Desalting good enough ? or have go with HPLC purity.

                Comment


                • #9
                  my sequencing primer

                  Hi Yepler,
                  Here are my sequencing primers, would you please take a look and tell me if you have any suggestion. Thank you.

                  CTACCGTCGGAT+CGTG+CGTGT
                  ACGAGATCCGTAATC+GGGAA+GC+TGAAG

                  Comment


                  • #10
                    To the best of my ability to tell, I think those should work out for you. Good luck, and please do let me know how it turns out.

                    Comment


                    • #11
                      new sequencing primers

                      Hi Yepler, the run with new sequencing primers worked perfectly. Thanks.

                      Comment

                      Latest Articles

                      Collapse

                      • seqadmin
                        Current Approaches to Protein Sequencing
                        by seqadmin


                        Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                        04-04-2024, 04:25 PM
                      • seqadmin
                        Strategies for Sequencing Challenging Samples
                        by seqadmin


                        Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
                        03-22-2024, 06:39 AM

                      ad_right_rmr

                      Collapse

                      News

                      Collapse

                      Topics Statistics Last Post
                      Started by seqadmin, 04-11-2024, 12:08 PM
                      0 responses
                      25 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 04-10-2024, 10:19 PM
                      0 responses
                      29 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 04-10-2024, 09:21 AM
                      0 responses
                      25 views
                      0 likes
                      Last Post seqadmin  
                      Started by seqadmin, 04-04-2024, 09:00 AM
                      0 responses
                      52 views
                      0 likes
                      Last Post seqadmin  
                      Working...
                      X