paired end quality scores

[oregon]

I'm new at bioinformatics, and just got a paired end (120bp) set of Illumina sequences, the sequence_2 file looks like I'm used to but the sequence_1 looks like this:


@GRC13_0025_FC:8:1:8024:1022#0/1
NAGTGAGTAGTCAAAAGAATAGTTCTATCCGACTTAACCAAAGCTAACATCTTCTGAACATCAATCCGTGCAGCAGGATCCATTCCAGCAGTTGGTTCATCCAAAAGAATCACTTTACTCC
+GRC13_0025_FC:8:1:8024:1022#0/1
BQNNMMLMRLY[Y[[WVOQQWJWXXYVYYYMMTQOMNOQNVOTVTXXWWW_____TY[[YRRWWMJRRRTWPTRTPTVTV_____BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@GRC13_0025_FC:8:1:8161:1016#0/1
NTCTTCATCGTCAGGCACTGGAAAGTGATTATGCGTCATCTCATCTTCATGAATGGATTGATCTGATTTTCGGATATAAACAGAATGGAGAAGAGGCAGTGAAGGAAAGAAGCAATTATTT
+GRC13_0025_FC:8:1:8161:1016#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@GRC13_0025_FC:8:1:8180:1012#0/1
NTCATTTAGAAAAAATAGAAACGATATTGAAGATAAAGTACGAATAATTATAGACCTGACAGTTGATGAGGTAGAAAGTGTAAAAATTAGATCTGAGAAAATTCAAGTAGATGGGCATTGA
+GRC13_0025_FC:8:1:8180:1012#0/1
BUUUUXXXXXbbQQQQQQ___b____b_________b__________b__b___b__b___bbbb_b_______b___bbbb___b_______T___b__QQ_____Z_Z___________


I have been looking at RAD sequencing data, and interpreting the 2nd line as fastq scores but if that's true for these, the quality is really poor. Is that true or do the paired end reads have a different file format? Thanks for any advice!

[fkrueger]

Hi Oregon,

the 4th line of a FastQ file shows the basecall qualities for the bases in line 2. Paired-end data is normally arranged so that each of the paired end files contains the sequences on either end in the same order throughout both files.
The quality score 'B' (Phred score 2) is not a generic low quality value but has a special meaning which was already discussed in a previous thread:

http://seqanswers.com/forums/showthread.php?t=4721&highlight=quality+score+illumina+special

Perhaps it is related to this new 'feature' of Pipeline 1.3+? See SLIDE 17 in http://docs.google.com/fileview?id=0...NTUyNDE3&hl=en. Here is the text of the slide:

"The Read Segment Quality Control Indicator: At the ends of some reads, quality scores are unreliable. Illumina has an algorithm for identifying these unreliable runs of quality scores, and we use a special indicator to flag these portions of reads A quality score of 2, encoded as a "B", is used as a special indicator. A quality score of 2 does not imply a specific error rate, but rather implies that the marked region of the read should not be used for downstream analysis. Some reads will end with a run of B (or Q2) basecalls, but there will never be an isolated Q2 basecall."

Also, looking at the first few (hundred) lines of a FastQ file only can give you a wrong impression, as they can contain more than 100 million lines. Using a quality control tool such as FastQC might help you to get a better idea of your sequencing data.

Best wishes

[oregon]

thanks!

Thanks for the reply- I used two fastq analysis programs and they are both showing terrible quality scores- I guess I will get in touch with our sequencing people and see what is going on.